Review



pcmvpax2  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Addgene inc pcmvpax2
    Pcmvpax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcmvpax2/pcmvpax2/pmc06309505__mmc2-269-2-10
    Average 90 stars, based on 1 article reviews
    pcmvpax2 - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Software:

    Article Title: ALDH1 Bio-activates Nifuroxazide to Eradicate ALDH High Melanoma-Initiating Cells
    Article Snippet: Experimental Models: Organisms/Strains Mouse: NOD SCID Charles River RRID:IMSR_ARC:NODSCID Oligonucleotides siRNA sequence; Silencer Select; ALDH1A3, GUAUCGAAGAAGUGAUAAA Life technology Cat#4390824 gRNA sequence, ALDH1A3; CACCGCTACATGTAACCCTTCAACT This paper N/A Recombinant DNA ALDH1A3 human cDNA clone pCMV6-XL4 vector Origene Cat#SC119706 pCMV6-XL4 vector Origene Cat#PCMV6XL4 lentiCas9-Blast vector (Sanjana et al., 2014) Addgene; 52962 lentiGuide-Puro vector (Sanjana et al., 2014) Addgene; 1000000049 (Continued on next page) Cell Chemical Biology 25, 1456–1469.e1–e6, December 20, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCMVPAX2 (Lang et al., 2000) Addgene; 36052 VSV.G (Reya et al., 2003) Addgene; 14888 Software and Algorithms MaxQuant version 1.5.7.4 http://www.coxdocs.orgi Uniprot Human Proteome, Release 2017_02 http://www.uniprot.org/proteomes/ ..



    Similar Products

    pcmvpax2  (Addgene inc)
    90
    Addgene inc pcmvpax2
    Pcmvpax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcmvpax2/pcmvpax2/pmc06309505__mmc2-269-2-10
    Average 90 stars, based on 1 article reviews
    pcmvpax2 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    packaging plasmids pcmvpax2  (Addgene inc)
    92
    Addgene inc packaging plasmids pcmvpax2

    Packaging Plasmids Pcmvpax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcmvpax2/pCMV-Pax2+(Plasmid+%2336052)/pmc06309505-367-17-20
    Average 92 stars, based on 1 article reviews
    packaging plasmids pcmvpax2 - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: Cell Chemical Biology

    Article Title: ALDH1 Bio-activates Nifuroxazide to Eradicate ALDH High Melanoma-Initiating Cells

    doi: 10.1016/j.chembiol.2018.09.005

    Figure Lengend Snippet:

    Article Snippet: The lentiviral vector was produced by transfection of 293T (ATCC) cells with the lentiviral vector plasmid and packaging plasmids pCMVPAX2 (Addgene; 36052) and VSV-g (Addgene; 14888) with polyethylenimine transfection reagent following manufacturer’s instructions.

    Techniques: Virus, Recombinant, Lysis, Protease Inhibitor, Binding Assay, Apoptosis Assay, Polymer, Blocking Assay, Bradford Assay, Transfection, Sequencing, Plasmid Preparation, Software